logo

SCIENCE CHINA Chemistry, Volume 60, Issue 3: 370-376(2017) https://doi.org/10.1007/s11426-016-0159-2

Synthesis of aptamer-functionalized Ag nanoclusters for MCF-7 breast cancer cells imaging

More info
  • ReceivedApr 10, 2016
  • AcceptedMay 20, 2016
  • PublishedNov 24, 2016

Abstract

Aptamer-functionalized silver nanoclusters (Ag NCs) have been attracting a lot of interest as label-free probes which have been successfully applied to both cell imaging and molecular detection. MUC1 aptamer is an ssDNA aptamer that specifically binds to MUC1 mucin which is a large transmembrane glycoprotein whose expression level increases at least 10-fold in primary and metastatic breast cancers. Using C4A4C3-linker-MUC1 as template, the Ag NCs were synthesized through one-pot process. The fluorescence intensity of Ag NCs was found to be closely related to the length and type (poly adenine or thymine) of the linker, the optimum linker being –AAAAA–. Using the C4A4C3-A5-MUC1 as the scaffold, the synthesized Ag NCs emitted fluorescence with high quantum yield (QY) of 66.5%. Based on the specific interaction between the MUC1 aptamer and MUC1 mucin, the C4A4C3-A5-MUC1-stabilized Ag NCs could recognize and differentiate the MCF-7 breast cancer cells from MDA-MB-231 breast cancer and A549 human lung cancer cells.


Funded by

State Key Basic Research Program of the PRC(2014CB744501)

National Natural Science Foundation of China(61271056,61527806)

Natural Science Foundation of Jiangsu Province(BK20141332)

National Youth Science Foundation of China(61301043)

the Priority Academic Program Development of Jiangsu Higher Education Institutions

and the Fundamental Research Funds for the Central Universities.


Acknowledgment

This work was supported by the National Basic Research Program of China (2014CB744501), the National Natural Science Foundation of China (61271056, 61527806), the Natural Science Foundation of Jiangsu Province (BK20141332), the National Youth Science Foundation of China (61301043), the Priority Academic Program Development of Jiangsu Higher Education Institutions, and the Fundamental Research Funds for the Central Universities.


Interest statement

The authors declare that they have no conflict of interest.


References

[1] Yeh HC, Sharma J, Han JJ, Martinez JS, Werner JH. Nano Lett, 2010, 10: 3106-3110 CrossRef PubMed ADS Google Scholar

[2] Yang SW, Vosch T. Anal Chem, 2011, 83: 6935-6939 CrossRef PubMed Google Scholar

[3] Sharma J, Yeh HC, Yoo H, Werner JH, Martinez JS. Chem Commun, 2011, 47: 2294–2296. Google Scholar

[4] Lee J, Park J, Lee HH, Kim HI, Kim WJ. J Mater Chem B, 2014, 2: 2616-2621 CrossRef Google Scholar

[5] Yin J, He X, Wang K, Qing Z, Wu X, Shi H, Yang X. Nanoscale, 2012, 4: 110-112 CrossRef PubMed ADS Google Scholar

[6] Li J, Zhong X, Cheng F, Zhang JR, Jiang LP, Zhu JJ. Anal Chem, 2012, 84: 4140-4146 CrossRef PubMed Google Scholar

[7] Yin J, He X, Wang K, Xu F, Shangguan J, He D, Shi H. Anal Chem, 2013, 85: 12011-12019 CrossRef PubMed Google Scholar

[8] Ono A, Cao S, Togashi H, Tashiro M, Fujimoto T, Machinami T, Oda S, Miyake Y, Okamoto I, Tanaka Y. Chem Commun, 2008, 39: 4825 CrossRef PubMed Google Scholar

[9] Okamoto I, Iwamoto K, Watanabe Y, Miyake Y, Ono A. Angew Chem Int Ed, 2009, 48: 1648-1651 CrossRef PubMed Google Scholar

[10] Megger DA, Fonseca Guerra C, Hoffmann J, Brutschy B, Bickelhaupt FM, Müller J. Chem Eur J, 2011, 17: 6533-6544 CrossRef PubMed Google Scholar

[11] Ono A, Torigoe H, Tanaka Y, Okamoto I. Chem Soc Rev, 2011, 40: 5855-5866 CrossRef PubMed Google Scholar

[12] Yang X, Gan L, Han L, Wang E, Wang J. Angew Chem Int Ed, 2013, 52: 2022-2026 CrossRef PubMed Google Scholar

[13] Zhou XH, Kong DM, Shen HX. Anal Chem, 2010, 82: 789-793 CrossRef PubMed Google Scholar

[14] Gwinn EG, O'Neill P, Guerrero AJ, Bouwmeester D, Fygenson DK. Adv Mater, 2008, 20: 279-283 CrossRef Google Scholar

[15] Richards CI, Choi S, Hsiang JC, Antoku Y, Vosch T, Bongiorno A, Tzeng YL, Dickson RM. J Am Chem Soc, 2008, 130: 5038-5039 CrossRef PubMed Google Scholar

[16] Li T, He N, Wang J, Li S, Deng Y, Wang Z. RSC Adv, 2016, 6: 22839-22844 CrossRef Google Scholar

[17] Xi Z, Huang R, Li Z, He N, Wang T, Su E, Deng Y. ACS Appl Mater Interfaces, 2015, 7: 11215-11223 CrossRef Google Scholar

[18] Zhao X, Huang Y, Yang CJ, Mao B. Sci China Chem, 2015, 58: 1858-1865 CrossRef Google Scholar

[19] Xi Z, Huang R, Deng Y, He N. J Biomed Nanotechnol, 2014, 10: 3043-3062 CrossRef Google Scholar

[20] Guo F, Hu Y, Yu L, Deng X, Meng J, Wang C, Yang XD. J Nanosci Nanotechnol, 2016, 16: 2246-2253 CrossRef Google Scholar

[21] Sun Z, Wang Y, Wei Y, Liu R, Zhu H, Cui Y, Zhao Y, Gao X. Chem Commun, 2011, 47: 11960-11962 CrossRef PubMed Google Scholar

[22] Jiang H, Xu G, Sun Y, Zheng W, Zhu X, Wang B, Zhang X, Wang G. Chem Commun, 2015, 51: 11810-11813 CrossRef PubMed Google Scholar

[23] Ludwig JA, Weinstein JN. Nat Rev Cancer, 2005, 5: 845-856 CrossRef PubMed Google Scholar

[24] Won JY, Choi JW, Min J. Biosens Bioelectron, 2013, 40: 161–166. Google Scholar

[25] Jayasena SD. Clinic Chem, 1999, 45: 1628–1650. Google Scholar

[26] Huang R, Xi Z, He N. Sci China Chem, 2015, 58: 1122-1130 CrossRef Google Scholar

[27] Kong RM, Chen Z, Ye M, Zhang XB, Tan WH. Sci China Chem, 2011, 54: 1218-1226 CrossRef Google Scholar

[28] Ferreira CSM, Papamichael K, Guilbault G, Schwarzacher T, Gariepy J, Missailidis S. Anal Bioanal Chem, 2008, 390: 1039-1050 CrossRef PubMed Google Scholar

[29] Li J, Jia X, Li D, Ren J, Han Y, Xia Y, Wang E. Nanoscale, 2013, 5: 6131-6138 CrossRef PubMed ADS Google Scholar

[30] Sengupta B, Springer K, Buckman JG, Story SP, Abe OH, Hasan ZW, Prudowsky ZD, Rudisill SE, Degtyareva NN, Petty JT. J Phys Chem C, 2009, 113: 19518-19524 CrossRef Google Scholar

  • Figure 1

    Schematic representation of MCF-7 breast cancer cells detection based on MUC1 apatmer functionalized Ag NCs. C4A4C3 sequence is connected with MUC1 aptamer via –AAAAA– linker. Silver ion is binding to C4A4C3 sequence and reduced to silver cluster. The synthesized Ag NCs get into cells and bind to MUC1 mucin after incubation with cells. MCF-7 breast cancer cells can be stained due to overexpression of MUC1 mucin. Partial enlarged details are schematic representation of combination between Ag NCs and MUC1 mucin (color online).

  • Figure 2

    (a) Fluorescence emission spectra of Ag NCs combined with MUC1 aptamer at 5′ or 3′ end; (b) effect of linker length on the fluorescence emission of MUC1 aptamer functionalized Ag NCs. The excitation wavelength is 560 nm (color online).

  • Figure 3

    (a) Effect of pH on the fluorescence emission of C4A4C3-A5-MUC1 templated Ag NCs; (b) effect of pH on the fluorescence emission of C4A4C3 oligonucleotide templated Ag NCs; (c) effect of oligonucleotide/Ag+ molar ratio on the fluorescence emission of C4A4C3-A5-MUC1 templated Ag NCs; (d) effect of oligonucleotide/Ag+ molar ratio on the fluorescence emission of C4A4C3 oligonucleotide templated Ag NCs (color online).

  • Figure 4

    Temporal change in fluorescence intensity of C4A4C3-A5-MUC1 and C4A4C3 templated Ag NCs. The excitation and emission wavelengths are 550 and 610 nm, respectively (color online).

  • Figure 5

    (a) Ultraviolet absorption spectra and fluorescence emission spectra of C4A4C3-A5-MUC1 templated Ag NCs; (b) fluorescence emission spectra of C4A4C3-A5-MUC1 templated Ag NCs excited at various wavelengths; (c) ultraviolet absorption spectra and fluorescence emission spectra of C4A4C3 oligonucleotide templated Ag NCs; (d) fluorescence emission spectra of C4A4C3 oligonucleotide templated Ag NCs excited at various wavelength (color online).

  • Figure 6

    (a) TEM image of C4A4C3-A5-MUC1 templated Ag NCs; (b) particle size distribution of Ag NCs (the mean diameter is 2.0±0.4 nm); (c) the TEM image of C4A4C3 oligonucleotide templated Ag NCs; (d) particle size distribution of Ag NCs (the mean diameter is 1.2±0.2 nm) (color online).

  • Figure 7

    Confocal laser scanning microscopy of (A) MCF-7 human breast cancer cells without staining, (B) MCF-7 human breast cancer cells, (C) MDA-MB-231 human breast cancer cells, (D) A549 human lung cancer cells incubated with C4A4C3-A5-MUC1 stabilized Ag NCs at 37 °C for 30 min. (a) Ag NCs fluorescence images; (b) bright-field images; (c) overlapping of corresponding fluorescence image and bright-field image. The Ag NCs were excited with 552 nm (color online).

  • Table 1   Oligonucleotides used in this study

    Name

    Sequence (5′-3′)

    C4A4C3

    CCCCAAAACCC

    C4A4C3-A4-MUC1

    CCCCAAAACCCAAAAGCAGTTGATCCTTTGGATACCCTGG

    C4A4C3-A5-MUC1

    CCCCAAAACCCAAAAAGCAGTTGATCCTTTGGATACCCTGG

    C4A4C3-A6-MUC1

    CCCCAAAACCCAAAAAAGCAGTTGATCCTTTGGATACCCTGG

    C4A4C3-T5-MUC1

    CCCCAAAACCCTTTTTGCAGTTGATCCTTTGGATACCCTGG

    C4A4C3-T8-MUC1

    CCCCAAAACCCTTTTTTTTGCAGTTGATCCTTTGGATACCCTGG

    C4A4C3-T10-MUC1

    CCCCAAAACCCTTTTTTTTTTGCAGTTGATCCTTTGGATACCCTGG

    MUC1-A5-C4A4C3

    GCAGTTGATCCTTTGGATACCCTGGAAAAACCCCAAAACCC

Copyright 2019 Science China Press Co., Ltd. 《中国科学》杂志社有限责任公司 版权所有

京ICP备18024590号-1