logo

SCIENCE CHINA Chemistry, Volume 60, Issue 10: 1318-1323(2017) https://doi.org/10.1007/s11426-017-9108-5

Nanocarrier based on the assembly of protein and antisense oligonucleotide to combat multidrug resistance in tumor cells

More info
  • ReceivedMay 16, 2017
  • AcceptedJul 6, 2017
  • PublishedAug 11, 2017

Abstract

Chemotherapy-induced multi-drug resistance (MDR) in tumors poses a huge challenge for clinical treatment of tumors. The downregulation of the multi-drug resistance relative protein, represented by P-glycoprotein (P-gp), can reverse MDR of cancer cells. In this study, we developed doxorubicin-loading nanocarrier based on the assembly of protein and antisense oligonucleotide (ASO) to combat MDR of cancer cells. The data demonstrate that the nanocarrier can efficiently deliver ASO to cytoplasm and downregulate the P-glycoprotein expression, subsequently improving the therapeutic effects of Dox in doxorubicin-resistant MCF-7/ADR cancer cells. The preparation is simple and effective, providing a powerful tool for gene delivery. Therefore, our nanocarrier shows high promise in cancer treatment.


Funded by

NSFC(Grants 21325520,21327009,21405041,J1210040)

Foundation for Innovative Research Groups of NSFC(Grant 21521063)

science and technology project of Hunan Province(2016RS2009,2016WK2002)


Acknowledgment

This work was supported by the National Natural Science Foundation of China (21325520, 21327009, 21405041, J1210040), the Foundation for Innovative Research Groups of National Natural Science Foundation of China (21521063), and the Science and Technology Project of Hunan Province (2016RS2009, 2016WK2002).


Interest statement

The authors declare that they have no conflict of interest.


References

[1] Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D, Bray F. Int J Cancer, 2015, 136: E359-E386 CrossRef PubMed Google Scholar

[2] Poultsides GA, Servais EL, Saltz LB, Patil S, Kemeny NE, Guillem JG, Weiser M, Temple LKF, Wong WD, Paty PB. J Clin Oncol, 2009, 27: 3379-3384 CrossRef PubMed Google Scholar

[3] Eisenkop SM, Spirtos NM, Friedman RL, Lin WCM, Pisani AL, Perticucci S. Gynecol Oncol, 2003, 90: 390-396 CrossRef Google Scholar

[4] Fisher B, Anderson S, Bryant J, Margolese RG, Deutsch M, Fisher ER, Jeong JH, Wolmark N. N Engl J Med, 2002, 347: 1233-1241 CrossRef PubMed Google Scholar

[5] Fisher B, Redmond C, Dimitrov NV, Bowman D, Legault-Poisson S, Wigkerham DL, Wolmark N, Fisher ER, Margolese R, Sutherland C, Glass A, Foster R, Caplan R. N Engl J Med, 1989, 320: 473-478 CrossRef PubMed Google Scholar

[6] Goodman LS. J Am Med Assoc, 1946, 132: 126-132 CrossRef Google Scholar

[7] Bonadonna G, Brusamolino E, Valagussa P, Rossi A, Brugnatelli L, Brambilla C, De Lena M, Tancini G, Bajetta E, Musumeci R, Veronesi U. N Engl J Med, 1976, 294: 405-410 CrossRef PubMed Google Scholar

[8] Stillman B. Science, 1996, 274: 1659-1663 CrossRef ADS Google Scholar

[9] Amaral N, Vendrell A, Funaya C, Idrissi FZ, Maier M, Kumar A, Neurohr G, Colomina N, Torres-Rosell J, Geli MI, Mendoza M. Nat Cell Biol, 2016, 18: 516-526 CrossRef PubMed Google Scholar

[10] Green DM, Nolan VG, Goodman PJ, Whitton JA, Srivastava DK, Leisenring WM, Neglia JP, Sklar CA, Kaste SC, Hudson MM, Diller LR, Stovall M, Donaldson SS, Robison LL. Pediatr Blood Cancer, 2014, 61: 53-67 CrossRef PubMed Google Scholar

[11] Green DM, Liu W, Kutteh WH, Ke RW, Shelton KC, Sklar CA, Chemaitilly W, Pui CH, Klosky JL, Spunt SL, Metzger ML, Srivastava DK, Ness KK, Robison LL, Hudson MM. Lancet Oncology, 2014, 15: 1215-1223 CrossRef Google Scholar

[12] Jordheim LP, Barakat KH, Heinrich-Balard L, Matera EL, Cros-Perrial E, Bouledrak K, El Sabeh R, Perez-Pineiro R, Wishart DS, Cohen R, Tuszynski J, Dumontet C. Mol Pharmacol, 2013, 84: 12-24 CrossRef PubMed Google Scholar

[13] Romain S, Martin PM, Klijn JGM, van Putten WLJ, Look MP, Guirou O, Foekens JA. Int J Cancer, 1997, 74: 156-161 CrossRef Google Scholar

[14] Booser DJ, Hortobagyi GN. Drugs, 1994, 47: 223-258 CrossRef Google Scholar

[15] Basso AD, Solit DB, Munster PN, Rosen N. Oncogene, 2002, 21: 1159-1166 CrossRef PubMed Google Scholar

[16] Dassonneville L, Lansiaux A, Wattelet A, Wattez N, Mahieu C, Van Miert S, Pieters L, Bailly C. Eur J Pharmacol, 2000, 409: 9-18 CrossRef Google Scholar

[17] Dassonneville L, Bonjean K, De Pauw-Gillet MC, Colson P, Houssier C, Quetin-Leclercq J, Angenot L, Bailly C. Biochemistry, 1999, 38: 7719-7726 CrossRef PubMed Google Scholar

[18] Kaaks R, Berrino F, Key T, Rinaldi S, Dossus L, Biessy C, Secreto G, Amiano P, Bingham S, Boeing H, Bueno de Mesquita HB, Chang-Claude J, Clavel-Chapelon F, Fournier A, van Gils CH, Gonzalez CA, Gurrea AB, Critselis E, Khaw KT, Krogh V, Lahmann PH, Nagel G, Olsen A, Onland-Moret NC, Overvad K, Palli D, Panico S, Peeters P, Quirós JR, Roddam A, Thiebaut A, Tjønneland A, Chirlaque MD, Trichopoulou A, Trichopoulos D, Tumino R, Vineis P, Norat T, Ferrari P, Slimani N, Riboli E. J Natl Cancer Inst, 2005, 97: 755-765 CrossRef PubMed Google Scholar

[19] Villena-Heinsen C, Diesing D, Fischer D, Griesinger G, Maas N, Diedrich K, Friedrich M. Anticancer Res, 2006, 26: 4817–4823. Google Scholar

[20] Callister M, Ramondetta LM, Jhingran A, Burke TW, Eifel PJ. Int J Radiat Oncol, 2004, 58: 786-796 CrossRef Google Scholar

[21] Hyde SC, Emsley P, Hartshorn MJ, Mimmack MM, Gileadi U, Pearce SR, Gallagher MP, Gill DR, Hubbard RE, Higgins CF. Nature, 1990, 346: 362-365 CrossRef PubMed ADS Google Scholar

[22] Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Proc Natl Acad Sci USA, 1987, 84: 7735-7738 CrossRef Google Scholar

[23] Gottesman MM, Fojo T, Bates SE. Nat Rev Cancer, 2002, 2: 48-58 CrossRef PubMed Google Scholar

[24] Dönmez Y, Akhmetova L, İşeri ÖD, Kars MD, Gündüz U. Cancer Chemoth Pharm, 2011, 67: 823-828 CrossRef PubMed Google Scholar

[25] Zgurskaya HI, Nikaido H. Mol Microbiol, 2000, 37: 219-225 CrossRef Google Scholar

[26] Ling V. Cancer Chemoth Pharm, 1997, 40: S3-S8 CrossRef Google Scholar

[27] Krishna R, Mayer LD. Eur J Pharm Sci, 2000, 11: 265-283 CrossRef Google Scholar

[28] Conde J, Oliva N, Artzi N. Proc Natl Acad Sci USA, 2015, 112: E1278-E1287 CrossRef PubMed ADS Google Scholar

[29] Mo R, Jiang T, DiSanto R, Tai W, Gu Z. Nat Commun, 2014, 5: 1–10. Google Scholar

[30] Sorgi FL, Bhattacharya S, Huang L. Gene Ther, 1997, 4: 961-968 CrossRef PubMed Google Scholar

  • Figure 1

    Drug delivery of Dox by NCs to cancer cells to combat MDR in cancer cells (color online).

  • Figure 2

    (a) The fluorescence spectra of the Dox solution (3 µM) with increasing molar ratios of DNA duplex (concentration 0 to 4 µM from top to bottom); (b) the particle size and Zeta potential of cNCs at different mass ratios of PS and dsDNA; (c) the particle size and Zeta potential of NCs at different mass ratios of PS and HAS; (d) the particle size and Zeta potential of dsDNA, cNCs and NCs (color online).

  • Figure 3

    Size invesitigation of cNCs and NCs. (a) DNA:PS (w/w)=4:5; (b) DNA:PS (w/w)=4:10; (c) DNA:PS (w/w)=4:15; (d) cNCs:HAS (w/w)=10:5; (e) cNCs:HSA (w/w)=10:10; (f) cNCs:HSA (w/w)=10:15 (color online).

  • Figure 4

    Fluorescent imaging analysis of MCF-7/ADR cells treated with free Dox (a–c) or FAM-Dox/NCs at equivalent Dox (d–f). (a, b) Free Dox is hard to enter the MCF-7/ADR cells proved by little fluorescence; (d, e) NCs is easy to enter the MCF-7/ADR cells proved by obvious fluorescence; (c, f) are taken in the bright field. The concentration of free Dox is 1.5 μM, and NCs with 1 μM ASO carriers 1.5 μM concentration of Dox (color online).

  • Figure 5

    Western blot analysis with antibodies against P-gp and GAP. Samples were from MCF-7/ADR cells treated with D-PBS, UNCs and NCs respectively. The final concentration of NCs and UNCs is both 2 μM (color online).

  • Figure 6

    (a) The normalized cell viability of MCF-7/ADR cells incubated with Dox/NCs (black), Dox/UNCs (red) and free Dox (blue) respectively; (b) the normalized cell viability of MCF-7 cells incubated with Dox/NCs (black), Dox/UNCs (red) and free Dox (blue) respectively. The concentration of free Dox is 1.5 times to the concentration of ASO of Dox/NCs and Dox/UNCs (color online).

  • Table 1   DNA sequences used in this study

    DNA

    Sequence (5¢-3¢)

    MDR1 mRNA

    GGAGCGCGAGGTCGGGATGG

    ASO

    CCATCCCGACCTCGCGCTCC

    cDNA

    GGAGCGCGAGGTC

    FAM-labeld cDNA

    FAM-GGAGCGCGAGGTC

    Control

    TTTATTTGAGGACGCGCACC

    cDNA of control

    CCTGCGCGTGGTC

Copyright 2019 Science China Press Co., Ltd. 《中国科学》杂志社有限责任公司 版权所有

京ICP备18024590号-1