logo

Journals Books
Advanced Search
Sign in Register

中文

SCIENCE CHINA Chemistry
Download PDF
SCIENCE CHINA Chemistry, Volume 63 , Issue 1 : 99-106(2020) https://doi.org/10.1007/s11426-019-9617-7

Preparation of biomimetic gene hydrogel via polymerase chain reaction for cell-free protein expression

Feng Li , Wenting Yu , Xue Zhang , Xiaocui Guo , Xihan Xu , Xiaolei Sun , Dayong Yang *
More info
  • ReceivedAug 8, 2019
  • AcceptedSep 19, 2019
  • PublishedNov 13, 2019
Previous Table of Contents Next
Share
Rating

Abstract

Deoxyribonucleic acid (DNA) hydrogels, a three-dimensional (3D) network made from DNA chains, have attracted great attention because of its molecular programmability, excellent biocompatibility and wide biomedical applications. Construction of hydrogel incorporating genetic function is still a challenge because of the limitations in available preparation methods. Herein, we develop a polymerase chain reaction (PCR) based strategy to construct gene integrated hydrogel to mimic the biofunction of nucleus zone. DNA primers were chemically modified by methacrylamide, which were used as modular primers in PCR to hybridize with template plasmid DNA, yielding methacrylamide functionalized gene (Acry-gene). Afterwards, Acry-gene was chemically cross-linked and compressed via free radical polymerization of terminal group methacrylamide to form a three-dimensional gene network, namely gene hydrogel. The gene hydrogel retained the genetic function and expressed protein successfully in a cell free protein expression system. This work provides a general approach for the construction of biofunctional gene hydrogel which mimics bioprocesses, showing great potential in biomedicine and biomimetic fields.


Funded by

the National Natural Science Foundation of China(21621004,21575101,21622404)


Acknowledgment

This work was supported by the National Natural Science Foundation of China (21621004, 21575101, 21622404).


Interest statement

The authors declare that they have no conflict of interest.


Contributions statement

These authors contributed equally to this work.


Supplement

The supporting information is available online at http://chem.scichina.com and http://link.springer.com/journal/11426. The supporting materials are published as submitted, without typesetting or editing. The responsibility for scientific accuracy and content remains entirely with the authors.


References

[1] Yang D, Hartman MR, Derrien TL, Hamada S, An D, Yancey KG, Cheng R, Ma M, Luo D. Acc Chem Res, 2014, 47: 1902-1911 CrossRef PubMed Google Scholar

[2] Wang F, Liu X, Willner I. Angew Chem Int Ed, 2015, 54: 1098-1129 CrossRef PubMed Google Scholar

[3] Song P, Ye D, Song S, Wang L, Zuo X. Prog Chem, 2016, 28: 628–636. Google Scholar

[4] Chen J, Yuan S, Song Y, Ma Q, Qi X, Wu Z. J Int Pharm Res, 2017, 44: 935–940, 946. Google Scholar

[5] Shao Y, Li C, Zhou X, Wu F, Jia H, Wang Y, Liu D. Polym Bull, 2015, 9: 100–108. Google Scholar

[6] Pei H, Zuo X, Zhu D, Huang Q, Fan C. Acc Chem Res, 2014, 47: 550-559 CrossRef PubMed Google Scholar

[7] Seeman NC. Nature, 2003, 421: 427-431 CrossRef PubMed ADS Google Scholar

[8] Storhoff JJ, Mirkin CA. Chem Rev, 1999, 99: 1849-1862 CrossRef Google Scholar

[9] Geng J, Yao C, Kou X, Tang J, Luo D, Yang D. Adv Healthcare Mater, 2018, 7: 1700998 CrossRef PubMed Google Scholar

[10] Kahn JS, Hu Y, Willner I. Acc Chem Res, 2017, 50: 680-690 CrossRef PubMed Google Scholar

[11] Bian B, Zhang YY, Dong YC, Wu F, Wang C, Wang S, Xu Y, Liu DS. Sci China Chem, 2018, 61: 1568-1571 CrossRef Google Scholar

[12] Liu Y, Hu X, Fu T, Wang R, Tan W. Sci China Chem, 2019, 62: 407-408 CrossRef Google Scholar

[13] Shao Y, Jia H, Cao T, Liu D. Acc Chem Res, 2017, 50: 659-668 CrossRef PubMed Google Scholar

[14] Zinchenko A, Che Y, Taniguchi S, Lopatina LI, Sergeyev VG, Murata S. J Nanopart Res, 2016, 18: 179 CrossRef ADS Google Scholar

[15] Mao X, Chen G, Wang Z, Zhang Y, Zhu X, Li G. Chem Sci, 2018, 9: 811-818 CrossRef PubMed Google Scholar

[16] Caliari SR, Burdick JA. Nat Methods, 2016, 13: 405-414 CrossRef PubMed Google Scholar

[17] Cangialosi A, Yoon CK, Liu J, Huang Q, Guo J, Nguyen TD, Gracias DH, Schulman R. Science, 2017, 357: 1126-1130 CrossRef PubMed ADS Google Scholar

[18] Wu Y, Wang D, Willner I, Tian Y, Jiang L. Angew Chem Int Ed, 2018, 57: 7790-7794 CrossRef PubMed Google Scholar

[19] Yang L, Yao C, Li F, Dong Y, Zhang Z, Yang D. Small, 2018, 14: 1800185 CrossRef PubMed Google Scholar

[20] Nöll T, Wenderhold-Reeb S, Schönherr H, Nöll G. Angew Chem Int Ed, 2017, 56: 12004-12008 CrossRef PubMed Google Scholar

[21] Cheng E, Xing Y, Chen P, Yang Y, Sun Y, Zhou D, Xu L, Fan Q, Liu D. Angew Chem Int Ed, 2009, 48: 7660-7663 CrossRef PubMed Google Scholar

[22] Li C, Faulkner-Jones A, Dun AR, Jin J, Chen P, Xing Y, Yang Z, Li Z, Shu W, Liu D, Duncan RR. Angew Chem Int Ed, 2015, 54: 3957-3961 CrossRef PubMed Google Scholar

[23] Wang J, Chao J, Liu H, Su S, Wang L, Huang W, Willner I, Fan C. Angew Chem Int Ed, 2017, 56: 2171-2175 CrossRef PubMed Google Scholar

[24] Um SH, Lee JB, Park N, Kwon SY, Umbach CC, Luo D. Nat Mater, 2006, 5: 797-801 CrossRef PubMed ADS Google Scholar

[25] Park N, Um SH, Funabashi H, Xu J, Luo D. Nat Mater, 2009, 8: 432-437 CrossRef PubMed ADS Google Scholar

[26] Lee JB, Peng S, Yang D, Roh YH, Funabashi H, Park N, Rice EJ, Chen L, Long R, Wu M, Luo D. Nat Nanotech, 2012, 7: 816-820 CrossRef PubMed ADS Google Scholar

[27] Xing Y, Cheng E, Yang Y, Chen P, Zhang T, Sun Y, Yang Z, Liu D. Adv Mater, 2011, 23: 1117-1121 CrossRef PubMed Google Scholar

[28] Xu W, Huang Y, Zhao H, Li P, Liu G, Li J, Zhu C, Tian L. Chem Eur J, 2017, 23: 18276-18281 CrossRef PubMed Google Scholar

[29] Huang Y, Xu W, Liu G, Tian L. Chem Commun, 2017, 53: 3038-3041 CrossRef PubMed Google Scholar

[30] Li J, Zheng C, Cansiz S, Wu C, Xu J, Cui C, Liu Y, Hou W, Wang Y, Zhang L, Teng I, Yang HH, Tan W. J Am Chem Soc, 2015, 137: 1412-1415 CrossRef PubMed Google Scholar

[31] Bartlett JMS, Stirling D. Methods Mol Biol, 2003, 226: 3–6. Google Scholar

[32] Eguchi Y, Kato T, Tanaka T, Maruyama T. Chem Commun, 2017, 53: 5802-5805 CrossRef PubMed Google Scholar

[33] Hartman MR, Yang D, Tran TNN, Lee K, Kahn JS, Kiatwuthinon P, Yancey KG, Trotsenko O, Minko S, Luo D. Angew Chem Int Ed, 2013, 52: 8699-8702 CrossRef PubMed Google Scholar

[34] Yang D, Peng S, Hartman MR, Gupton-Campolongo T, Rice EJ, Chang AK, Gu Z, Lu GQM, Luo D. Sci Rep, 2013, 3: 3165 CrossRef PubMed ADS Google Scholar

[35] Perez JG, Stark JC, Jewett MC. Cold Spring Harb Perspect Biol, 2016, 8: a023853 CrossRef PubMed Google Scholar

  • Click to view Download high-quality image

    Figure 1

    Agarose gel electrophoresis analysis of PCR produced Acry-eGFP and the effect of concentration of APS on the free radical polymerization of Acry-eGFP. (a) Schematic diagram of the preparation of polymerized-gene. (b) Gel electrophoresis image of Acry-eGFP with 1,235 bp synthesized by PCR using pRset-eGFP plasmid as template. (c) Gel electrophoresis image of chemically cross-linked Acry-eGFP with 1,235 bp via free radical polymerization. Each electrophoresis band represented an initiator in different mass concentrations. (d) Acry-eGFP with 2,393 bp synthesized by PCR using pRset-eGFP plasmid as template. (e) Gel electrophoresis image of chemically cross-linked Acry-eGFP with 2,393 bp via free radical polymerization. Each electrophoresis band represented an initiator in different mass concentrations (color online).

  • Click to view Download high-quality image

    Scheme 1

    Scheme of the preparation of gene hydrogel and protein expression in a CFPS system. Acry-primer sequences hybrided with plasmid DNA template and were extended by polymerase to synthesize Acry-gene via PCR process. Acry-gene was afterwards cross-linked via free radical polymerization of methacrylamide groups to form a 3D gene network, namely gene hydrogel. The gene hydrogel preserved the biological function of DNA and expressed protein in CFPS system (color online).

  • Click to view Download high-quality image

    Figure 2

    Formation and rheological property of gene hydrogel. (a) The ultraviolet imaging of Hydrogel-1235 and Hydrogel-2393 formed with different concentrations of Acry-eGFP (1,235 bp) and Acry-eGFP (2,393 bp), respectively. The hydrogels were stained by SYBR Green I. (b) Time dependent development of the storage modulus G′ and the loss modulus G″ of Hydrogel-1235. (c) Time dependent development of the storage modulus G′ and the loss modulus G″ of Hydrogel-2393 (color online).

  • Click to view Download high-quality image

    Figure 3

    SEM and fluorescence microscopy of gene hydrogel. (a, b) The morphology of Hydrogel-1235 (the arrow indicates nanofibers); (c) the fluorescence microscope image of the Hydrogel-1235 (stained with SYBR Green I); (d, e) the morphology of Hydrogel-2393; (f) the fluorescence microscope image of the Hydrogel-2393 (stained with SYBR Green I) (color online).

  • Click to view Download high-quality image

    Figure 4

    Protein expression of gene hydrogel in a CFPS system. (a) Schematic illustration of protein expression in a gene hydrogel containing CFPS system; (b) time course of the eGFP expressed from Acry-eGFP Hydrogel-1235 in a CFPS system; (c) time course of the eGFP expressed from Acry-eGFP Hydrogel-2393 in a CFPS system (color online).

  • Table 1   Oligonucleotides used in PCR

    Name

    Sequence

    Use

    Primer 1

    TAACCGTATTACCGCCTTTGAGT

    Forward primer for PCR

    Primer 2

    GCGGGCCTCTTCGCTATTA

    Reverse primer for PCR

    Primer 3

    GCGGGCCTCTTCGCTATTA

    Reverse primer for PCR

Copyright 2020 Science China Press Co., Ltd. 《中国科学》杂志社有限责任公司 版权所有

京ICP备17057255号       京公网安备11010102003388号